Gene Name | transmembrane protein 181A | Gene Symbol | Tmem181a | |||
Chromosome | 17 | Genomic Location | chr17:6,270,000-6,307,000 | ![]() |
||
Synonyms | C76977, Gpr178, Tmem181, mKIAA1423, 5930418K15Rik | |||||
Links |
UCSC Genome Browser(chr17:6,270,000-6,307,000) NCBI Gene(77106) IGTC(Tmem181a,23714) UNIGene(Mm.381893) |
MGI(1924356) KEGG GENES(mmu:77106) EST Profile(mm.381893) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB467273 | GSS Location | chr17:6,270,457-6,270,590 | Size | 135 |
Sequence | GGCAGTCGCGCTCTGATGCGTTTTCCGCGCCCGGCTGCTTGGCTTCCCTGGTGGCTCCGGCGGCG GCTTCGGGACGCCGGGCGAACTCGGGACGATCCGGCGGGGACCGGGGACCCGAGGCTCGGAGATG GAACC |
||||
Links |
UCSC Browser(chr17:6,270,457-6,270,590) IGTC(Ayu21-W69) |
[AK154554] Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630047E11 product:hypothetical protein, full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Tmem181a) |