ID 21-W73
Registered: 2008.10.26 Last update: 2016.06.06
| Gene Name | aspartyl-tRNA synthetase | Gene Symbol | Dars | |||
| Chromosome | 1 | Genomic Location | chr1:130,259,000-130,315,000 |  |
||
| Synonyms | 5730439G15Rik | |||||
| Links |
UCSC Genome Browser(chr1:130,259,000-130,315,000) NCBI Gene(226414) IGTC(Dars,31) UNIGene(Mm.28693) |
MGI(2442544) KEGG GENES(mmu:226414) EST Profile(mm.28693) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB467274 | GSS Location | chr1:130,301,943-130,310,310 | Size | 177 |
| Sequence | TAAGGACCTGACAGTTCAAAAAGCTGATGATGTTGTTTGGGTCCGTGCAAGAGTTCATACAAGCA GAGCAAAAGGGAAGCAGTGCTTCTTAGTCCTGAGGCAGCAGCAGTTTAATGTCCAGGCTCTTGTG GCGGTGGGAGACCATGCAAGCAAGCAGATGGTTAAATTTGCAGCCAA |
||||
| Links |
UCSC Browser(chr1:130,301,943-130,310,310) IGTC(Ayu21-W73) |
||||
Homology Search Results
| [BC008638] Mus musculus aspartyl-tRNA synthetase, mRNA (cDNA clone MGC:6719 IMAGE:3586278), complete cds. |
Mouse Information
| Card ID | 2330 | ||||
| Strain Name | B6.Cg-DarsGt(pU-21W)73Card | ||||
| Internal Code | Ayu21-W73 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Dars) |
||||