ID 21-W76
Registered: 2008.04.30 Last update: 2017.02.05
| Gene Name | serine racemase | Gene Symbol | Srr | |||
| Chromosome | 11 | Genomic Location | chr11:74,720,000-74,740,000 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr11:74,720,000-74,740,000) NCBI Gene(27364) IGTC(Srr,35992) UNIGene(Mm.131443) |
MGI(1351636) KEGG GENES(mmu:27364) EST Profile(mm.131443) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB435414 | GSS Location | chr11:74,739,086-74,739,158 | Size | 73 |
| Sequence | GAGGCTCGGAGGTGGAGGCGCAGCGCTCTGGAGGCGAGGTGAGGCGCAGCCAGGTGTGACTCGCC CATGTCAG |
||||
| Links |
UCSC Browser(chr11:74,739,086-74,739,158) IGTC(Ayu21-W76) |
||||
Homology Search Results
| [AK079343] Mus musculus 16 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:9630033L03 product:serine racemase, full insert sequence. |
Mouse Information
| Card ID | 1439 | ||||
| Strain Name | B6;CB-SrrGt(pU-21W)76Card | ||||
| Internal Code | Ayu21-W76 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. [Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071. |
||||
| Links |
IMSR (for Srr) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |