ID 21-W83

Registered: 2008.04.30   Last update: 2018.10.28
Gene Name erythrocyte membrane protein band 4.1 like 1 Gene Symbol Epb41l1
Chromosome 2 Genomic Location chr2:156,245,000-156,370,000
Synonyms Epb4.1l1, 4.1N
Links UCSC Genome Browser(chr2:156,245,000-156,370,000)
NCBI Gene(13821)
IGTC(Epb41l1,2732)
UNIGene(Mm.20852)
MGI(103010)
KEGG GENES(mmu:13821)
EST Profile(mm.20852)
Other Clone Trapped This Gene
Trap Vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB435416 GSS Location chr2:156,258,734-156,264,369 Size 147
Sequence CCTACTGTGAAGTACTGTTTCTGGGGCTCCTTCCTTCCCAGGGGCAGCCNGCCACTNGGACCTTT
TTCCCCCTGCCTCCAGCAGAGGTGACCTTGGAGGTGCCTGGCTGAGGACGTCCTCCCCAGGGAGC
CGGTGTGCCGAGGAGGG
Links UCSC Browser(chr2:156,258,734-156,264,369)
IGTC(Ayu21-W83)

Homology Search Results

[AK147611] Mus musculus adult male brain UNDEFINED_CELL_LINE cDNA, RIKEN full-length enriched library, clone:M5C1089G17 product:erythrocyte protein band 4.1-like 1, full insert sequence.

Mouse Information

Card ID 1215
Strain Name B6;CB-Epb4.1l1Gt(pU-21W)83Card
Internal Code Ayu21-W83
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Epb41l1)

Expression Information

DescriptionX-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female