Gene Name | erythrocyte membrane protein band 4.1 like 1 | Gene Symbol | Epb41l1 | |||
Chromosome | 2 | Genomic Location | chr2:156,245,000-156,370,000 | |||
Synonyms | Epb4.1l1, 4.1N | |||||
Links |
UCSC Genome Browser(chr2:156,245,000-156,370,000) NCBI Gene(13821) IGTC(Epb41l1,2732) UNIGene(Mm.20852) |
MGI(103010) KEGG GENES(mmu:13821) EST Profile(mm.20852) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB435416 | GSS Location | chr2:156,258,734-156,264,369 | Size | 147 |
Sequence | CCTACTGTGAAGTACTGTTTCTGGGGCTCCTTCCTTCCCAGGGGCAGCCNGCCACTNGGACCTTT TTCCCCCTGCCTCCAGCAGAGGTGACCTTGGAGGTGCCTGGCTGAGGACGTCCTCCCCAGGGAGC CGGTGTGCCGAGGAGGG |
||||
Links |
UCSC Browser(chr2:156,258,734-156,264,369) IGTC(Ayu21-W83) |
[AK147611] Mus musculus adult male brain UNDEFINED_CELL_LINE cDNA, RIKEN full-length enriched library, clone:M5C1089G17 product:erythrocyte protein band 4.1-like 1, full insert sequence. |
Card ID | 1215 | ||||
Strain Name | B6;CB-Epb4.1l1Gt(pU-21W)83Card | ||||
Internal Code | Ayu21-W83 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Epb41l1) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |