Gene Name | ubiquitin-conjugating enzyme E2N | Gene Symbol | Ube2n | |||
Chromosome | 10 | Genomic Location | chr10:94,977,000-95,010,000 | ![]() |
||
Synonyms | UBC13 | |||||
Links |
UCSC Genome Browser(chr10:94,977,000-95,010,000) NCBI Gene(93765) IGTC(Ube2n,15170) UNIGene(Mm.371667) |
MGI(1934835) KEGG GENES(mmu:93765) EST Profile(mm.371667) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB435418 | GSS Location | chr10:94,977,779-94,977,871 | Size | 94 |
Sequence | ACTCGAGCGTGAGGAGAGCGGAGCCGGAGACAAGAGCAGAGGCCGAACTCGGGATCTGACAAGAT GGCCGGGCTGCCCCGCAGGGATCATCAAG |
||||
Links |
UCSC Browser(chr10:94,977,779-94,977,871) IGTC(Ayu21-W85) |
[AK005302] Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500026J17 product:ubiquitin-conjugating enzyme E2N, full insert sequence. |
Card ID | 1368 | ||||
Strain Name | B6;CB-Ube2nGt(pU-21W)85Card | ||||
Internal Code | Ayu21-W85 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Ube2n) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |