ID 21-W98
Registered: 2008.09.21 Last update: 2010.02.26
| Gene Name | ubiquitin-like, containing PHD and RING finger domains, 1 | Gene Symbol | Uhrf1 | |||
| Chromosome | 17 | Genomic Location | chr17:56,442,000-56,465,000 |  |
||
| Synonyms | Np95, ICBP90 | |||||
| Links |
UCSC Genome Browser(chr17:56,442,000-56,465,000) NCBI Gene(18140) IGTC(Uhrf1,1340) UNIGene(Mm.42196) |
MGI(1338889) KEGG GENES(mmu:18140) EST Profile(mm.42196) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB458545 | GSS Location | chr17:56,442,742-56,442,983 | Size | 242 |
| Sequence | CAAGAGCCCTCCCCCACCCAATTGGGGTGGAAGTCTCCCGCAGCAGCCTGTGCACACTAATAAAA ACGCCCTGAGTTTTCGCGGGAAAAAAAGTCCTAGCAGCTGGAAGGAACCCGCGCTCTAGTGCTCA CTTGGGTCTTCAGCCACTCACGCGGCTCCCTTCTGGGTCACCCAGCCGCAGAGCCCTAGCCTAGA ACCAGGCGTTCCAAGGGAGAGGAGAGTGCGGATCGCCGCCGTAGAGA |
||||
| Links |
UCSC Browser(chr17:56,442,742-56,442,983) IGTC(Ayu21-W98) |
||||
Homology Search Results
| [NM_010931] Mus musculus ubiquitin-like, containing PHD and RING finger domains, 1 (Uhrf1), transcript variant 1, mRNA. |
Mouse Information
| Card ID | 1438 | ||||
| Strain Name | B6;CB-Uhrf1Gt(pU-21W)98Card | ||||
| Internal Code | Ayu21-W98 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Uhrf1) |
||||