ID K10A10

Registered: 2013.09.29   Last update: 2016.01.06
Gene Name CDC42 small effector 1 Gene Symbol Cdc42se1
Chromosome 3 Genomic Location chr3:95,032,591-95,040,665
Synonyms SCIP1, Spec1, Cdcse1, AW558204, 1300002M12Rik
Links UCSC Genome Browser(chr3:95,032,591-95,040,665)
NCBI Gene(57912)
IGTC(Cdc42se1,14780)
UNIGene(Mm.28189)
 MGI(1889510)
KEGG GENES(mmu:57912)
EST Profile(mm.28189)
Other Clone Trapped This Gene
Trap Vector pCMT-SAhygpA-NP21 Cell Line vdR2-4 Method Splinkerette PCR
Accession AB735710 GSS Location chr3:95,034,007-95,034,107 Size 101
Sequence ATCATTGGTGGTTTCACGCCAAGTCCCACACACACTTTCCCTCCACCCAGCTTGGTCAGGTCCCT
GGAAGAGAAACAGAACTGTCCTTGTTCCCTCCTCGG
Links UCSC Browser(chr3:95,034,007-95,034,107)
IGTC(AyuK10A10)

Homology Search Results

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the gene trap vector pCMT-SAhygpA-NP21 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR.
[Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066.
Links IMSR (for Cdc42se1)