ID K12A07

Registered: 2013.10.09   Last update: 2016.01.06
Gene Name protein phosphatase 6, regulatory subunit 3 Gene Symbol Ppp6r3
Chromosome 19 Genomic Location chr19:3,452,905-3,579,758
Synonyms 4930528G08Rik, 9130026N02Rik, D19Bwg1430e, D19Ertd703e, mKIAA1558, Pp6r3, Pptcs3, Saps3
Links UCSC Genome Browser(chr19:3,452,905-3,579,758)
NCBI Gene(52036)
IGTC(Ppp6r3,3132)
UNIGene(Mm.284686)
 MGI(1921807)
KEGG GENES(mmu:52036)
EST Profile(mm.284686)
Other Clone Trapped This Gene
Trap Vector pCMT-SAhygpA-NP21 Cell Line vdR2-4 Method Splinkerette PCR
Accession AG999710 GSS Location chr19:3,533,027-3,533,107 Size 81
Sequence GTCCCGTGTGCCCCCCCACCCACACACAGGGTTTCTCTATAGCTTTGGCTGTCCTGGAACTTACT
TTGTAGACCAGGCTGG
Links UCSC Browser(chr19:3,533,027-3,533,107)
IGTC(AuK12A07)

Homology Search Results

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the gene trap vector pCMT-SAhygpA-NP21 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR.
[Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066.
Links IMSR (for Ppp6r3)