ID K15G06

Registered: 2014.02.24   Last update: 2016.01.06
Gene Name capping protein (actin filament) muscle Z-line, alpha 2 Gene Symbol Capza2
Chromosome 6 Genomic Location chr6:17,586,289-17,617,490
Synonyms Cappa2, AW208808, 1110053K06Rik
Links UCSC Genome Browser(chr6:17,586,289-17,617,490)
NCBI Gene(12343)
IGTC(Capza2,8686)
UNIGene(Mm.)
 MGI(106222)
KEGG GENES(mmu:12343)
EST Profile(mm.)
Other Clone Trapped This Gene
Trap Vector pCMT-SAhygpA-NP22 Cell Line vdR2-4 Method Splinkerette PCR
Accession AG999742 GSS Location chr6:17,593,159-17,593,208 Size 50
Sequence CTAGTCCATGTGCTTGTGGGGGCATTTCATATACACACCACGATATCTGG
Links UCSC Browser(chr6:17,593,159-17,593,208)
IGTC(AyuK15G06)

Homology Search Results

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the gene trap vector pCMT-SAhygpA-NP22 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR.
[Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066.
Links IMSR (for Capza2)