ID K17A06

Registered: 2014.02.24   Last update: 2016.01.06
Gene Name tripartite motif-containing 6 Gene Symbol Trim6
Chromosome 7 Genomic Location chr7:111,366,668-111,384,239
Synonyms D7Ertd684e, C430046K18Rik
Links UCSC Genome Browser(chr7:111,366,668-111,384,239)
NCBI Gene(94088)
IGTC(Trim6,30742)
UNIGene(Mm.274843)
 MGI(2137352)
KEGG GENES(mmu:94088)
EST Profile(mm.274843)
Other Clone Trapped This Gene
Trap Vector pT2F2-SAhygpA-NP21 Cell Line vdR2-4 Method Splinkerette PCR
Accession AG999737 GSS Location chr7:111,370,341-111,370,547 Size 207
Sequence CCCTGGAGTCTTTCTCTTTTATTTGATACTAATTTGATCTTCTCCTCCAGAGCCGTCAGACTATC
CTAGTCTAAAATAGAAGAAACACCAATTCCTTTGTTTGCATACAAGAAGTGTTATCTAATATGTC
CCATCAGAATAAGAAGTGACAAAGATTCTGATAAAGTAGAAAATGGAGCCGCTGTGTAATTTTAA
GTTTTCAGTTAG
Links UCSC Browser(chr7:111,370,341-111,370,547)
IGTC(AyuK17A06)

Homology Search Results

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the gene trap vector pT2F2-SAhygpA-NP21 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR.
[Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066.
Links IMSR (for Trim6)