ID K17G03

Registered: 2013.12.26   Last update: 2016.01.06
Gene Name general transcription factor II H, polypeptide 1 Gene Symbol Gtf2h1
Chromosome 7 Genomic Location chr7:54,050,636-54,080,671
Synonyms p62, 62kDa, C77871, AW743425, AW822074, BTF2 p62
Links UCSC Genome Browser(chr7:54,050,636-54,080,671)
NCBI Gene(14884)
IGTC(Gtf2h1,4005)
UNIGene(Mm.22700)
MGI(1277216)
KEGG GENES(mmu:14884)
EST Profile(mm.22700)
Other Clone Trapped This Gene
Trap Vector pT2F2-SAhygpA-NP21 Cell Line vdR2-4 Method Splinkerette PCR
Accession AG999730 GSS Location chr7:54,051,644-54,051,709 Size 66
Sequence CGTAGCTCCCACCTGGTAAGTTGAGACCGAAGAATGGGGTTGGGCGGGCGTGGAGGGTCTGACAG
G
Links UCSC Browser(chr7:54,051,644-54,051,709)
IGTC(AyuK17G03)

Homology Search Results

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the gene trap vector pT2F2-SAhygpA-NP21 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR.
[Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066.
Links IMSR (for Gtf2h1)