ID K17H08

Registered: 2014.02.26   Last update: 2016.01.06
Gene Name poly(rC) binding protein 2 Gene Symbol Pcbp2
Chromosome 15 Genomic Location chr15:102,300,000-102,332,000
Synonyms Hnrpx, AW412548, MGC107004, alphaCP-2
Links UCSC Genome Browser(chr15:102,300,000-102,332,000)
NCBI Gene(18521)
IGTC(Pcbp2,5046)
UNIGene(Mm.236513)
 MGI(108202)
KEGG GENES(mmu:18521)
EST Profile(mm.236513)
Other Clone Trapped This Gene
21-W324
Trap Vector pT2F2-SAhygpA-NP21 Cell Line vdR2-4 Method Splinkerette PCR
Accession AG999760 GSS Location chr15:102,304,078-102,304,214 Size 137
Sequence GTTACGGTTACTTAATTTTAGAAAGAAGATTTTGTTTTGGATTTTCAGTGGTACTGGAGATTGAA
CTCAGGGTATCTAGGCAAATACCATTAAACTAACCCAGGCCTCTACATATTATACAAAGTTGTGG
ATTTTTT
Links UCSC Browser(chr15:102,304,078-102,304,214)
IGTC(AyuK17H08)

Homology Search Results

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the gene trap vector pT2F2-SAhygpA-NP21 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR.
[Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066.
Links IMSR (for Pcbp2)