ID K19B07

Registered: 2014.02.23   Last update: 2016.01.06
Gene Name RAD9-HUS1-RAD1 interacting nuclear orphan 1 Gene Symbol Rhno1
Chromosome 6 Genomic Location chr6:128,306,770-128,313,170
Synonyms 2510047L19Rik, 5930416I19Rik
Links UCSC Genome Browser(chr6:128,306,770-128,313,170)
NCBI Gene(72440)
IGTC(Rhno1,)
UNIGene(Mm.143908)
 MGI(1915315)
KEGG GENES(mmu:72440)
EST Profile(mm.143908)
Other Clone Trapped This Gene
Trap Vector pT2F2-SAhygpA-NP21 Cell Line vdR2-4 Method Splinkerette PCR
Accession AG999736 GSS Location chr6:128,309,904-128,310,157 Size 255
Sequence CTAATGAGCATGTGCCCCATGTTCAGCTGTAGCCATCTTTGCATGTGGTGCCTGCCCCTCAGCCT
CCAGTGACCTTCCTGCTTTCTGCTTCTCCCAGCTCTCCTTCTACAGAAAGCCTTCTCTGACGTGA
ACCGTACTATACTGAGATGTGGCTGTTTCCTTCTAGTCAGCTCTCTCTTCTCCTTCCTTTCCTTC
TTCCTTGCCATTGTCCCCTCTTTTGCAGTTCTGGGGACTGAAACCTAAGGCTTTGTGCAT
Links UCSC Browser(chr6:128,309,904-128,310,157)
IGTC(AuK19B07)

Homology Search Results

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the gene trap vector pT2F2-SAhygpA-NP21 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR.
[Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066.
Links IMSR (for Rhno1)