ID K7G08

Registered: 2013.10.01   Last update: 2016.01.06
Gene Name RNA binding motif protein 5 Gene Symbol Rbm5
Chromosome 9 Genomic Location chr9:107,642,565-107,674,183
Synonyms D030069N10Rik
Links UCSC Genome Browser(chr9:107,642,565-107,674,183)
NCBI Gene(83486)
IGTC(Rbm5,660)
UNIGene(Mm.259197)
 MGI(1933204)
KEGG GENES(mmu:83486)
EST Profile(mm.259197)
Other Clone Trapped This Gene
Trap Vector pCMT-SAhygpA-NP21 Cell Line vdR2-4 Method Splinkerette PCR
Accession AB735723 GSS Location chr9:107,671,742-107,671,938 Size 197
Sequence GAAGCAGTGTGCTAGCTCTTCCGTGAGACGATGGGTTCAGACAAAAGGTGAGTTTCAATACATGA
CATGCCTTTGATCTCAACAGCTTAGTTGGGACTGAAATATTTGTTTAAAATTGTTTATTCAGCCC
TGTGTGGTGATGGCAGCTTACAGGTTTTAATCCCCGCAGAGACAGGCAAATCTCACTGAGTTCAA
GG
Links UCSC Browser(chr9:107,671,742-107,671,938)
IGTC(AyuK7G08)

Homology Search Results

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the gene trap vector pCMT-SAhygpA-NP21 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR.
[Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066.
Links IMSR (for Rbm5)