ID K8F07

Registered: 2013.12.15   Last update: 2016.01.06
Gene Name solute carrier family 39 (zinc transporter), member 14 Gene Symbol Slc39a14
Chromosome 14 Genomic Location chr14:70,702,037-70,752,750
Synonyms Zip14, ZIP-14, fad123, FAD-123
Links UCSC Genome Browser(chr14:70,702,037-70,752,750)
NCBI Gene(213053)
IGTC(Slc39a14,807)
UNIGene(Mm.270647)
 MGI(2384851)
KEGG GENES(mmu:213053)
EST Profile(mm.270647)
Other Clone Trapped This Gene
21-W489
Trap Vector pCMT-SAhygpA-NP21 Cell Line vdR2-4 Method Splinkerette PCR
Accession AG999722 GSS Location chr14:70,750,358-70,750,538 Size 181
Sequence CACTTAGGTTGGGACTGACCAAATTAGGTGGTCTGGTTACCGGCTGCTCCCTCTTAGAGTTTTAA
AGCTATAGCTAAAGTAGCCATCAGACTCACCTTGTGATCCTGAGGTAGATTCTAAGCCGGAAAAT
TGCCTCTCTGGGTTGTGGGTTCAGCTTTAAGAATCTTCTGTCACCCCGGGG
Links UCSC Browser(chr14:70,750,358-70,750,538)
IGTC(AuK8F07)

Homology Search Results

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the gene trap vector pCMT-SAhygpA-NP21 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR.
[Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066.
Links IMSR (for Slc39a14)