ID 21-18

Registered: 2004.06.01   Last update: 2018.03.26
Gene Name Basonuclin 2 Gene Symbol Bnc2
Chromosome 4 Genomic Location chr4:83,910,928-84,330,000
Synonyms 5031434M05Rik, 8430420F16Rik
Links UCSC Genome Browser(chr4:83,910,928-84,330,000)
NCBI Gene(242509)
IGTC(Bnc2,730)
UNIGene(Mm.190774)
 MGI(2443805)
KEGG GENES(mmu:242509)
EST Profile(mm.190774)
Other Clone Trapped This Gene
21-T516, 21-W217, 21-W281, 21-KBW265
Trap Vector pU-21 Cell Line KTPU10 Method 5'-RACE
Accession AB187235 GSS Location chr4:84,320,879-84,320,977 Size 107
Sequence AGGGCTGGGAGCGGCGAGCTGAGGCGGCCGAGGGGCTGGTCCAGGCGCGGCCGCTAAGAGGAGAC
CAAGAGGCGGGGGCTGCACTTGACAACCAGCATGCCGAGATG
Links UCSC Browser(chr4:84,320,879-84,320,977)
IGTC(Ayu21-18)

Homology Search Results

[AK031039] Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5832424E11 product:unclassifiable, full insert sequence.

Mouse Information

Card ID 345
Strain Name B6;CB-Bnc2Gt(pU-21)18Imeg
Internal Code Ayu21-18
Description This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Basonuclin 2 has a function in the multiplication of embryonic craniofacial mesenchymal cells and is orthologous to disco proteins." Vanhoutteghem, A., Maciejewski-Duval, A., Bouche, C., Delhomme, B., Herve, F., Daubigney, F., Soubigou, G., Araki, M., Araki, K., Yamamura, K., and Djian, P., Proc. Natl. Acad. Sci. USA, 106, 14432-14437 (2009). PubMed ID:19706529.
[Paper] "Human balanced translocation and mouse gene inactivation implicate Basonuclin 2 in distal urethral development." Bhoj, E., Ramos, P., Baker, LA., Cost, N., Nordenskjold, A., Elder, FF., Bleyl, SB., Bowles, NE., Arrington, CB., Delhomme, B., Vanhoutteghem, A., Djian, P. and Zinn, AR., European Journal of Human Genetics, 19, 540-546 (2011). PubMed ID:21368915.
[Paper] "The zinc-finger protein basonuclin 2 is required for proper mitotic arrest, prevention of premature meiotic initiation and meiotic progression in mouse male germ cells." Vanhoutteghem, A., Messiaen, S., Herve, F., Delhomme, B., Moison, D., Petit, JM., Rouiller-Fabre, V., Livera, G. and Djian, P., Development, 141 (22), 4298-4310 (2014). PubMed ID:25344072.
[Paper] "The importance of basonuclin 2 in adult mice and its relation to basonuclin 1." Vanhoutteghem, A., Delhomme, B., Herve, F., Nondier, I., Petit, JM., Araki, M., Araki, K., and Djian, P., Mechanisms of Development, 140, 53-73(2016). PubMed ID:26923665.
Links IMSR (for Bnc2)