| Gene Name | Basonuclin 2 | Gene Symbol | Bnc2 | |||
| Chromosome | 4 | Genomic Location | chr4:83,910,928-84,330,000 | |||
| Synonyms | 5031434M05Rik, 8430420F16Rik | |||||
| Links |
UCSC Genome Browser(chr4:83,910,928-84,330,000) NCBI Gene(242509) IGTC(Bnc2,730) UNIGene(Mm.190774) |
MGI(2443805) KEGG GENES(mmu:242509) EST Profile(mm.190774) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T516, 21-W217, 21-W281, 21-KBW265 |
| Trap Vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
| Accession | AB187235 | GSS Location | chr4:84,320,879-84,320,977 | Size | 107 |
| Sequence | AGGGCTGGGAGCGGCGAGCTGAGGCGGCCGAGGGGCTGGTCCAGGCGCGGCCGCTAAGAGGAGAC CAAGAGGCGGGGGCTGCACTTGACAACCAGCATGCCGAGATG |
||||
| Links |
UCSC Browser(chr4:84,320,879-84,320,977) IGTC(Ayu21-18) |
||||
| [AK031039] Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5832424E11 product:unclassifiable, full insert sequence. |
| Card ID | 345 | ||||
| Strain Name | B6;CB-Bnc2Gt(pU-21)18Imeg | ||||
| Internal Code | Ayu21-18 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. [Paper] "Basonuclin 2 has a function in the multiplication of embryonic craniofacial mesenchymal cells and is orthologous to disco proteins." Vanhoutteghem, A., Maciejewski-Duval, A., Bouche, C., Delhomme, B., Herve, F., Daubigney, F., Soubigou, G., Araki, M., Araki, K., Yamamura, K., and Djian, P., Proc. Natl. Acad. Sci. USA, 106, 14432-14437 (2009). PubMed ID:19706529. [Paper] "Human balanced translocation and mouse gene inactivation implicate Basonuclin 2 in distal urethral development." Bhoj, E., Ramos, P., Baker, LA., Cost, N., Nordenskjold, A., Elder, FF., Bleyl, SB., Bowles, NE., Arrington, CB., Delhomme, B., Vanhoutteghem, A., Djian, P. and Zinn, AR., European Journal of Human Genetics, 19, 540-546 (2011). PubMed ID:21368915. [Paper] "The zinc-finger protein basonuclin 2 is required for proper mitotic arrest, prevention of premature meiotic initiation and meiotic progression in mouse male germ cells." Vanhoutteghem, A., Messiaen, S., Herve, F., Delhomme, B., Moison, D., Petit, JM., Rouiller-Fabre, V., Livera, G. and Djian, P., Development, 141 (22), 4298-4310 (2014). PubMed ID:25344072. [Paper] "The importance of basonuclin 2 in adult mice and its relation to basonuclin 1." Vanhoutteghem, A., Delhomme, B., Herve, F., Nondier, I., Petit, JM., Araki, M., Araki, K., and Djian, P., Mechanisms of Development, 140, 53-73(2016). PubMed ID:26923665. |
||||
| Links |
IMSR (for Bnc2) |
||||