Gene Name | Basonuclin 2 | Gene Symbol | Bnc2 | |||
Chromosome | 4 | Genomic Location | chr4:83,915,000-84,325,000 | ![]() |
||
Synonyms | MGC124423, MGC124424, 5031434M05Rik, 8430420F16Rik | |||||
Links |
UCSC Genome Browser(chr4:83,915,000-84,325,000) NCBI Gene(242509) IGTC(Bnc2,730) UNIGene(Mm.190774) |
MGI(2443805) KEGG GENES(mmu:242509) EST Profile(mm.190774) |
Other Clone Trapped This Gene |
---|
21-T516, 21-W281, 21-KBW265, 21-18 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB495086 | GSS Location | chr4:84,320,879-84,321,034 | Size | 156 |
Sequence | GAGTGGCGCGGGCGGCGAGCGCGGCCCGGAGCGGCCGGGCGGGGGAGGGAGCAGGCCGAGCGGCG AGCTGAGGCGGCCGAGGGGCTGGTCCAGGCGCGGCCGCTAAGAGGAGACCAAGAGGCGGGGGCTG CACTTGACAACCAGCATGCCGAGATG |
||||
Links |
UCSC Browser(chr4:84,320,879-84,321,034) IGTC(Ayu21-W217) |
[AK031039] Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5832424E11 product:unclassifiable, full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Bnc2) |