| Gene Name | Basonuclin 2 | Gene Symbol | Bnc2 | |||
| Chromosome | 4 | Genomic Location | chr4:83,915,000-84,325,000 | |||
| Synonyms | MGC124423, MGC124424, 5031434M05Rik, 8430420F16Rik | |||||
| Links |
UCSC Genome Browser(chr4:83,915,000-84,325,000) NCBI Gene(242509) IGTC(Bnc2,730) UNIGene(Mm.190774) |
MGI(2443805) KEGG GENES(mmu:242509) EST Profile(mm.190774) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T516, 21-W217, 21-KBW265, 21-18 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB510935 | GSS Location | chr4:84,320,879-84,320,985 | Size | 107 |
| Sequence | AGCAGGCCGAGCGGCGAGCTGAGGCGGCCGAGGGGCTGGTCCAGGCGCGGCCGCTAAGAGGAGAC CAAGAGGCGGGGGCTGCACTTGACAACCAGCATGCCGAGATG |
||||
| Links |
UCSC Browser(chr4:84,320,879-84,320,985) IGTC(Ayu21-W281) |
||||
| [AK031039] Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5832424E11 product:unclassifiable, full insert sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Bnc2) |
||||