| Gene Name | plasmacytoma variant translocation 1 | Gene Symbol | Pvt1 | |||
| Chromosome | 15 | Genomic Location | chr15:61,860,000-62,220,000 | |||
| Synonyms | Pvt-1, Mlvi-1, Mis-1 | |||||
| Links |
UCSC Genome Browser(chr15:61,860,000-62,220,000) NCBI Gene(19296) IGTC(Pvt1,16691) UNIGene(Mm.4608) |
MGI(97824) KEGG GENES(mmu:) EST Profile(mm.4608) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-B147, 21-T74, 21-T245 |
| Trap Vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
| Accession | AB187251 | GSS Location | chr15:61,869,603-62,007,103 | Size | 236 |
| Sequence | AGCACATGGTCCCACTGGTCAAGCGGGCTCGGCAAGGCCAGGATGAAGAGAAGCTACGAACTTAG CATTCCCAGAGCCCCCCGAGTGGATATCCGCGTGGAAAGGATGTTGGCAGCCCCGGTGACCTCGG AGTCACGGCTGGATCCACCCTCTTTATACCCTTTAAGCGTTCCAGAAGGATTTTGAGATCCTTTC CTAAATCAAAGGTGGAATATTTGGGGATTTGGAAAATTGAG |
||||
| Links |
UCSC Browser(chr15:61,869,603-62,007,103) IGTC(Ayu21-84) |
||||
| [AK043252] Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:A730076G10 product:unclassifiable, full insert sequence. |
| Card ID | 440 | ||||
| Strain Name | B6;CB-Gt(Ayu21)84Imeg | ||||
| Internal Code | Ayu21-84 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Pvt1) |
||||