Gene Name | plasmacytoma variant translocation 1 | Gene Symbol | Pvt1 | |||
Chromosome | 15 | Genomic Location | chr15:61,853,279-62,216,938 | |||
Synonyms | Ayu21-84Imeg, Gt(Ayu21)84Imeg, Mis-1, Mlvi-1, Pvt-1, Gt(pU21)84Imeg | |||||
Links |
UCSC Genome Browser(chr15:61,853,279-62,216,938) NCBI Gene(19296) IGTC(Pvt1,16691) UNIGene(Mm.4608) |
MGI(97824) KEGG GENES(mmu:) EST Profile(mm.4608) |
Other Clone Trapped This Gene |
---|
21-84, 21-B147, 21-T245 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB277854 | GSS Location | chr15:61,869,558-61,869,756 | Size | 200 |
Sequence | CCCCGCCAGCCCCGCGCTCTACCAGGCAGAGCGCGTGTGGCCGCCGAGCACATGGACCCACTGGT CAAGCGGGCTCGGCAAGGCCAGGATGAAGAGAAGCTACGAACTTAGCATTCCCAGAGCCCCCCGA GTGGATATCCGCGTGGAAAGGATGTTGGCAGCCCCGGTGACCTCGGAGTCACGGCTGGATCCACC CTCTT |
||||
Links |
UCSC Browser(chr15:61,869,558-61,869,756) IGTC(Ayu21-T74) |
[AK043790] Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830033B22 product:unclassifiable, full insert sequence. |
Card ID | 969 | ||||
Strain Name | B6;CB-Pvt1Gt(pU-21T)74Imeg | ||||
Internal Code | Ayu21-T74 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Pvt1) |