ID 21-B147
Registered: 2005.12.21 Last update: 2018.04.05
| Gene Name | plasmacytoma variant translocation 1 | Gene Symbol | Pvt1 | |||
| Chromosome | 15 | Genomic Location | chr15:61,850,000-62,220,000 |  |
||
| Synonyms | Pvt-1, Mlvi-1, Mis-1, Ayu21-84Imeg, Gt(Ayu21)84Imeg, Gt(pU21)84Imeg | |||||
| Links |
UCSC Genome Browser(chr15:61,850,000-62,220,000) NCBI Gene(19296) IGTC(Pvt1,16691) UNIGene(Mm.4608) |
MGI(97824) KEGG GENES(mmu:) EST Profile(mm.4608) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-84, 21-T74, 21-T245 |
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB244787 | GSS Location | chr15:61,869,557-61,869,756 | Size | 200 |
| Sequence | ACCCGCCAGCCCCGCGCTCTACCAGGCAGAGCGCGTGTGGCCGCCGAGCACATGGACCCACTGGT CAAGCGGGCTCGGCAAGGCCAGGATGAAGAGAAGCTACGAACTTAGCATTCCCAGAGCCCCCCGA GTGGATATCCGCGTGGAAAGGATGTTGGCAGCCCCGGTGACCTCGGAGTCACGGCTGGATCCACC CTCTT |
||||
| Links |
UCSC Browser(chr15:61,869,557-61,869,756) IGTC(Ayu21-B147) |
||||
Homology Search Results
| [AK043790] Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830033B22 product:unclassifiable, full insert sequence. |
Mouse Information
| Card ID | 659 | ||||
| Strain Name | B6;CB-Pvt1Gt(pU-21B)147Imeg | ||||
| Internal Code | Ayu21-B147 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Pvt1) |
||||