ID 21-KBW122

Registered: 2008.10.06   Last update: 2022.08.01
Gene Name LIM domain and actin binding 1 Gene Symbol Lima1
Chromosome 15 Genomic Location chr15:99,607,000-99,707,000
Synonyms 1110021C24Rik, 3526402A12Rik, epithelial protein lost in neoplasm, EPLIN, Eplin
Links UCSC Genome Browser(chr15:99,607,000-99,707,000)
NCBI Gene(65970)
IGTC(Lima1,1323)
UNIGene(Mm.33207)
MGI(1920992)
KEGG GENES(mmu:65970)
EST Profile(mm.33207)
Other Clone Trapped This Gene
21-W43
Trap Vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB462912 GSS Location chr15:99,657,223-99,705,829 Size 260
Sequence GCGCTGGGCAGACAGAGCGCAGGACCGTGGCCGTGCAGCGCCGAGCCCCGACGGCTTTCTAGTCA
GCCCACAGGTGTCTCAGAGTCTGTAGACAAGATGGAATCGACTCCATTTAATAGACGCCAGTGGA
CTTCCCTGTCATTGAGAGTAACAGCCAAAGAGCTTTCTCTTGTCAACAAGAACAAGTCATCCGCA
ATTGTGGAAATATTCTCCAAGTACCAGAAGGCTGCTGAAGAAGCCAACAGGAAAGGAAGAAAAAT
Links UCSC Browser(chr15:99,657,223-99,705,829)
IGTC(Ayu21-KBW122)

Homology Search Results

[AF307845] Mus musculus epithelial protein lost in neoplasm-b (Eplin) mRNA, complete cds.

Mouse Information

Card ID 1305
Strain Name B6-Lima1Gt(pU-21KBW)122Card
Internal Code Ayu21-KBW122
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071.
[Paper] "EPLINβ Is Involved in the Assembly of Cadherin-catenin Complexes in Osteoblasts and Affects Bone Formation."Shihoko Miyazaki, Taro Funamoto, Tomohisa Sekimoto, Syuji Kurogi, Tomomi Ohta, Takuya Nagai, Takuya Tajima, Mai Imasaka, Kumiko Yoshinobu, Kimi Araki, Masatake Araki, Narantsog Choijookhuu, Yoshitaka Hishikawa and Etsuo Chosa, Acta Histochem. Cytochem.,55,99-110(2022). doi: 10.1267/ahc.22-00027. PubMed ID:35821749.
Links IMSR (for Lima1)

Expression Information

DescriptionX-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female