ID 21-W43
Registered: 2008.04.24 Last update: 2008.05.08
| Gene Name | LIM domain and actin binding 1 | Gene Symbol | Lima1 | |||
| Chromosome | 15 | Genomic Location | chr15:99,607,000-99,707,000 |  |
||
| Synonyms | EPLIN, epithelial protein lost in neoplasm | |||||
| Links |
UCSC Genome Browser(chr15:99,607,000-99,707,000) NCBI Gene(65970) IGTC(Lima1,1323) UNIGene(Mm.33207) |
MGI(1920992) KEGG GENES(mmu:65970) EST Profile(mm.33207) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW122 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB435090 | GSS Location | chr15:99,705,764-99,705,824 | Size | 62 |
| Sequence | GGGGCAGACAGAGCGCAGGACCGTGGCCGTGCAGCGCCGAGCCCCGACGGCTTTCTAGTCAG | ||||
| Links |
UCSC Browser(chr15:99,705,764-99,705,824) IGTC(Ayu21-W43) |
||||
Homology Search Results
| [AF307845] Mus musculus epithelial protein lost in neoplasm-b (Eplin) mRNA, complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Lima1) |
||||