Gene Name | LIM domain and actin binding 1 | Gene Symbol | Lima1 | |||
Chromosome | 15 | Genomic Location | chr15:99,607,000-99,707,000 | ![]() |
||
Synonyms | EPLIN, epithelial protein lost in neoplasm | |||||
Links |
UCSC Genome Browser(chr15:99,607,000-99,707,000) NCBI Gene(65970) IGTC(Lima1,1323) UNIGene(Mm.33207) |
MGI(1920992) KEGG GENES(mmu:65970) EST Profile(mm.33207) |
Other Clone Trapped This Gene |
---|
21-KBW122 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB435090 | GSS Location | chr15:99,705,764-99,705,824 | Size | 62 |
Sequence | GGGGCAGACAGAGCGCAGGACCGTGGCCGTGCAGCGCCGAGCCCCGACGGCTTTCTAGTCAG | ||||
Links |
UCSC Browser(chr15:99,705,764-99,705,824) IGTC(Ayu21-W43) |
[AF307845] Mus musculus epithelial protein lost in neoplasm-b (Eplin) mRNA, complete cds. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Lima1) |