Gene Name | CD9 antigen | Gene Symbol | Cd9 | |||
Chromosome | 6 | Genomic Location | chr6:125,410,000-125,446,000 | |||
Synonyms | Tspan29 | |||||
Links |
UCSC Genome Browser(chr6:125,410,000-125,446,000) NCBI Gene(12527) IGTC(Cd9,3753) UNIGene(Mm.210676) |
MGI(88348) KEGG GENES(mmu:12527) EST Profile(mm.210676) |
Other Clone Trapped This Gene |
---|
21-W496 |
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB604769 | GSS Location | chr6:125,444,592-125,444,738 | Size | 147 |
Sequence | GCAGCGTGTCTCAGTCGGTTGTCGAGTCCCTTCTGTCCCAGTCGTTCGTGCCTCTTGTCCCACGC AACTCCAGCTTGTACCATGCCGGTCAAAGGAGGTAGCAAGTGCATCAAATACCTGCTCTTCGGAT TTAACTTCATCTTCTGG |
||||
Links |
UCSC Browser(chr6:125,444,592-125,444,738) IGTC(Ayu21-KBW153) |
[NM_007657] Mus musculus CD9 antigen (Cd9), mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Cd9) |