ID 21-W496
Registered: 2010.07.15 Last update: 2011.09.21
| Gene Name | CD9 antigen | Gene Symbol | Cd9 | |||
| Chromosome | 6 | Genomic Location | chr6:125,410,000-125,446,000 |  |
||
| Synonyms | Tspan29 | |||||
| Links |
UCSC Genome Browser(chr6:125,410,000-125,446,000) NCBI Gene(12527) IGTC(Cd9,3753) UNIGene(Mm.210676) |
MGI(88348) KEGG GENES(mmu:12527) EST Profile(mm.210676) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW153 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB571320 | GSS Location | chr6:125,444,592-125,444,768 | Size | 178 |
| Sequence | AAAAGTGGAGCCTCAGGCCAGCCCCTAGCCGCAGCGTGTCTCAGTCGGTTGTCGAGTCCCTTCTG TCCCAGTCGTTCGTGCCTCCTTGTCCCACGCAACTCCAGCTTGTACCATGCCGGTCAAAGGAGGT AGCAAGTGCATCAAATACCTGCTCTTCGGATTTAACTTCATCTTCTGG |
||||
| Links |
UCSC Browser(chr6:125,444,592-125,444,768) IGTC(Ayu21-W496) |
||||
Homology Search Results
| [NM_007657] Mus musculus CD9 antigen (Cd9), mRNA. |
Mouse Information
| Card ID | 1764 | ||||
| Strain Name | B6;CB-<i>Cd9<sup>Gt(pU-21W)496Card</sup></i> | ||||
| Internal Code | Ayu21-W496 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA).Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Cd9) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |