| Gene Name | branched chain aminotransferase 1, cytosolic | Gene Symbol | Bcat1 | |||
| Chromosome | 6 | Genomic Location | chr6:144,940,000-145,026,000 | |||
| Synonyms | Bcat-1, BCATc, Eca39 | |||||
| Links |
UCSC Genome Browser(chr6:144,940,000-145,026,000) NCBI Gene(12035) IGTC(Bcat1,670) UNIGene(Mm.4606) |
MGI(104861) KEGG GENES(mmu:12035) EST Profile(mm.4606) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW240 |
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB624510 | GSS Location | chr6:145,024,409-145,024,494 | Size | 86 |
| Sequence | GGGTCACTGCACAGCCGCCTCCTCCAGAGGAGACTCACATTTGCACCCAGGAGCCGGAGCCACGA CCCAAGCCACGAGAAATGAAG |
||||
| Links |
UCSC Browser(chr6:145,024,409-145,024,494) IGTC(Ayu21-KBW207) |
||||
| [NM_007532] Mus musculus branched chain aminotransferase 1, cytosolic (Bcat1), transcript variant 2, mRNA. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Bcat1) |
||||