Gene Name | branched chain aminotransferase 1, cytosolic | Gene Symbol | Bcat1 | |||
Chromosome | 6 | Genomic Location | chr6:144,940,000-145,026,000 | ![]() |
||
Synonyms | Bcat-1, BCATc, Eca39 | |||||
Links |
UCSC Genome Browser(chr6:144,940,000-145,026,000) NCBI Gene(12035) IGTC(Bcat1,670) UNIGene(Mm.4606) |
MGI(104861) KEGG GENES(mmu:12035) EST Profile(mm.4606) |
Other Clone Trapped This Gene |
---|
21-KBW207 |
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB639759 | GSS Location | chr6:145,024,409-145,024,574 | Size | 166 |
Sequence | CAGTCGCTGCTGATGCAATCCGCAGCGGAGCGCGCCCAGCTCTCCATCTTCCGCGCTTGCCGACC GACCCTGAGCGCCACGTGTCACTGCACAGCCGCCTCCTCCAGAGGAGACTCACATTTGCACCCAG GAGCCGGAGCCACGACCCAAGCCACGAGAAATGAAG |
||||
Links |
UCSC Browser(chr6:145,024,409-145,024,574) IGTC(Ayu21-KBW240) |
[NM_007532] Mus musculus branched chain aminotransferase 1, cytosolic (Bcat1), transcript variant 2, mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Bcat1) |