ID 21-W153
Registered: 2008.11.05 Last update: 2018.06.15
| Gene Name | microtubule associated monooxygenase, calponin and LIM domain containing 3 | Gene Symbol | Mical3 | |||
| Chromosome | 6 | Genomic Location | chr6:120,945,000-121,085,000 |  |
||
| Synonyms | C130040D16Rik, MICAL-3, mKIAA1364, Mical-3 | |||||
| Links |
UCSC Genome Browser(chr6:120,945,000-121,085,000) NCBI Gene(194401) IGTC(Mical3,10302) UNIGene(Mm.122399) |
MGI(2442733) KEGG GENES(mmu:194401) EST Profile(mm.122399) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W9, 21-W305 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB469156 | GSS Location | chr6:121,060,035-121,060,098 | Size | 64 |
| Sequence | GCGTGTCCCGGCGCGCGGCTGGGTGGCCTCGCCGGCCACGAGGACACAGCAGCATGAAGCAGAG | ||||
| Links |
UCSC Browser(chr6:121,060,035-121,060,098) IGTC(Ayu21-W153) |
||||
Homology Search Results
| [AK122497] Mus musculus mRNA for mKIAA1364 protein. |
Mouse Information
| Card ID | 1264 | ||||
| Strain Name | B6;CB-Mical3Gt(pU-21W)153Card | ||||
| Internal Code | Ayu21-W153 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Mical3) |
||||