Gene Name | microtubule associated monooxygenase, calponin and LIM domain containing 3 | Gene Symbol | Mical3 | |||
Chromosome | 6 | Genomic Location | chr6:120,945,000-121,085,000 | ![]() |
||
Synonyms | MICAL-3, KIAA0819, mKIAA1364, C130040D16Rik | |||||
Links |
UCSC Genome Browser(chr6:120,945,000-121,085,000) NCBI Gene(194401) IGTC(Mical3,10302) UNIGene(Mm.122399) |
MGI(2442733) KEGG GENES(mmu:194401) EST Profile(mm.122399) |
Other Clone Trapped This Gene |
---|
21-W153, 21-W305 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB477045 | GSS Location | chr6:121,060,035-121,060,161 | Size | 127 |
Sequence | GCCGCCGCTACTGCTGCTGCTGCCGCGCCGGACGCTGCGGGCTAGCGCGCGGGGGCTGCGGCTGC GTGTCCCGGCGCGCGGCTGGGTGGCCTCGCCGGCCACGAGGACACAGCAGCATGAAGCAGAG |
||||
Links |
UCSC Browser(chr6:121,060,035-121,060,161) IGTC(Ayu21-W9) |
[AK122497] Mus musculus mRNA for mKIAA1364 protein. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Mical3) |