| Gene Name | coiled-coil domain containing 12 | Gene Symbol | Ccdc12 | |||
| Chromosome | 9 | Genomic Location | chr9:110,558,000-110,615,000 | |||
| Synonyms | C76605; 2700094L05Rik | |||||
| Links |
UCSC Genome Browser(chr9:110,558,000-110,615,000) NCBI Gene(72654) IGTC(Ccdc12,1241) UNIGene(Mm.249115) |
MGI(1919904) KEGG GENES(mmu:72654) EST Profile(mm.249115) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W219, 21-W278 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB466333 | GSS Location | chr9:110,559,024-110,559,162 | Size | 139 |
| Sequence | TGCGCGAGGCAGGAGTGAAAAGGAGGTGGGGGCCTCCGAAAAGATGGCGGCTGCTCCTGCCGGTG TGGGCCGCCTAGAGGAAGAGGCGCTGCGGCGGAAAGAACGGCTGAAGGCCCTCCGGGAGAAAACC GGGCGCAAG |
||||
| Links |
UCSC Browser(chr9:110,559,024-110,559,162) IGTC(Ayu21-W169) |
||||
| [AK012610] Mus musculus 11 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2700094L05 product:hypothetical protein, full insert sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Ccdc12) |
||||