Gene Name | coiled-coil domain containing 12 | Gene Symbol | Ccdc12 | |||
Chromosome | 9 | Genomic Location | chr9:110,558,000-110,615,000 | ![]() |
||
Synonyms | C76605, 2700094L05Rik | |||||
Links |
UCSC Genome Browser(chr9:110,558,000-110,615,000) NCBI Gene(72654) IGTC(Ccdc12,1241) UNIGene(Mm.249115) |
MGI(1919904) KEGG GENES(mmu:72654) EST Profile(mm.249115) |
Other Clone Trapped This Gene |
---|
21-W169, 21-W278 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB495088 | GSS Location | chr9:110,559,040-110,559,162 | Size | 123 |
Sequence | GAAAAGGAGGTGGGGGCCTCCGAAAAGATGGCGGCTGCTCCTGCCGGTGTGGGCCGCCTAGAGGA AGAGGCGCTGCGGCGGAAAGAACGGCTGAAGGCCCTCCGGGAGAAAACCGGGCGCAAG |
||||
Links |
UCSC Browser(chr9:110,559,040-110,559,162) IGTC(Ayu21-W219) |
[AK012610] Mus musculus 11 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2700094L05 product:hypothetical protein, full insert sequence. |
Card ID | 1309 | ||||
Strain Name | B6;CB-Cdc12Gt(pU-21W)219Card | ||||
Internal Code | Ayu21-W219 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Ccdc12) |