ID 21-W225

Registered: 2009.05.22   Last update: 2009.12.25
Gene Name ADP-ribosylation factor-like 15 Gene Symbol Arl15
Chromosome 13 Genomic Location chr13:114,570,000-114,950,000
Synonyms Arfrp2, A430036I03, C230032K13Rik
Links UCSC Genome Browser(chr13:114,570,000-114,950,000)
NCBI Gene(218639)
IGTC(Arl15,1780)
UNIGene(Mm.79837)
MGI(2442308)
KEGG GENES(mmu:218639)
EST Profile(mm.79837)
Other Clone Trapped This Gene
21-KBW194, 21-T275, 21-W242, 21-W454
Trap Vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB504286 GSS Location chr13:114,584,819-114,584,904 Size 86
Sequence CCGGGTTCGGAGCCATTCCGGATGCTTTAGGCTGCCGGATGTCTGATCTCCGGATAACTGAGGCG
TTTCTGTACATGGATTATCTG
Links UCSC Browser(chr13:114,584,819-114,584,904)
IGTC(Ayu21-W225)

Homology Search Results

[AK039965] Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430036I03 product:hypothetical ADP-ribosylation factors family/ATP/GTP-binding site motif A (P-loop)/SAR1 GTP-binding protein family containing protein, full insert sequence.

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Arl15)