Gene Name | ADP-ribosylation factor-like 15 | Gene Symbol | Arl15 | |||
Chromosome | 13 | Genomic Location | chr13:114,570,000-114,950,000 | ![]() |
||
Synonyms | Arfrp2, A430036I03, C230032K13Rik | |||||
Links |
UCSC Genome Browser(chr13:114,570,000-114,950,000) NCBI Gene(218639) IGTC(Arl15,1780) UNIGene(Mm.79837) |
MGI(2442308) KEGG GENES(mmu:218639) EST Profile(mm.79837) |
Other Clone Trapped This Gene |
---|
21-KBW194, 21-T275, 21-W242, 21-W225 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB562512 | GSS Location | chr13:114,584,819-114,584,904 | Size | 87 |
Sequence | CCGGGTTCGGAGCCATTCCGGATGCTTTAGGCTGCCGGATGTCTGATANTCCGGATAACTGAGGC GTTTCCTGTACAGGATTATCTG |
||||
Links |
UCSC Browser(chr13:114,584,819-114,584,904) IGTC(Ayu21-W454) |
[AK039965] Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430036I03 product:hypothetical ADP-ribosylation factors family/ATP/GTP-binding site motif A (P-loop)/SAR1 GTP-binding protein family containing protein, full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Arl15) |