ID 21-W454
Registered: 2010.05.20 Last update: 2010.08.25
| Gene Name | ADP-ribosylation factor-like 15 | Gene Symbol | Arl15 | |||
| Chromosome | 13 | Genomic Location | chr13:114,570,000-114,950,000 |  |
||
| Synonyms | Arfrp2, A430036I03, C230032K13Rik | |||||
| Links |
UCSC Genome Browser(chr13:114,570,000-114,950,000) NCBI Gene(218639) IGTC(Arl15,1780) UNIGene(Mm.79837) |
MGI(2442308) KEGG GENES(mmu:218639) EST Profile(mm.79837) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW194, 21-T275, 21-W242, 21-W225 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB562512 | GSS Location | chr13:114,584,819-114,584,904 | Size | 87 |
| Sequence | CCGGGTTCGGAGCCATTCCGGATGCTTTAGGCTGCCGGATGTCTGATANTCCGGATAACTGAGGC GTTTCCTGTACAGGATTATCTG |
||||
| Links |
UCSC Browser(chr13:114,584,819-114,584,904) IGTC(Ayu21-W454) |
||||
Homology Search Results
| [AK039965] Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430036I03 product:hypothetical ADP-ribosylation factors family/ATP/GTP-binding site motif A (P-loop)/SAR1 GTP-binding protein family containing protein, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Arl15) |
||||