ID 21-W226
Registered: 2009.05.22 Last update: 2010.07.06
| Gene Name | peroxisomal biogenesis factor 14 | Gene Symbol | Pex14 | |||
| Chromosome | 4 | Genomic Location | chr4:148,332,000-148,476,000 |  |
||
| Synonyms | Pex14p, R75137 | |||||
| Links |
UCSC Genome Browser(chr4:148,332,000-148,476,000) NCBI Gene(56273) IGTC(Pex14,2427) UNIGene(Mm.184172) |
MGI(1927868) KEGG GENES(mmu:56273) EST Profile(mm.184172) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W436 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB504287 | GSS Location | chr4:148,415,830-148,473,933 | Size | 186 |
| Sequence | AGTCAGGCCTGAGGAAGATGGCGTCGTCGGAGCAGGCAGAGCAGCCGAACCAGCCAAGCTNTCCT CCAGGAAGTGAAAATGTGGTGCCCCGAGAGCCACTGATTGCCACAGCAGTGAAGTTCCTACAGAA TTCTCGGGTCCGGCAGAGCCCACTTGCGACCAGGAGAGCATTTCTTAAGAAGAAAG |
||||
| Links |
UCSC Browser(chr4:148,415,830-148,473,933) IGTC(Ayu21-W226) |
||||
Homology Search Results
| [AF097512] Mus musculus peroxisomal protein (Pex14) mRNA, complete cds. |
Mouse Information
| Card ID | 1311 | ||||
| Strain Name | B6;CB-Pex14Gt(pU-21W)226Card | ||||
| Internal Code | Ayu21-W226 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Pex14) |
||||