ID 21-W436
Registered: 2010.05.02 Last update: 2010.08.25
| Gene Name | peroxisomal biogenesis factor 14 | Gene Symbol | Pex14 | |||
| Chromosome | 4 | Genomic Location | chr4:148,332,000-148,476,000 |  |
||
| Synonyms | Pex14p, R75137 | |||||
| Links |
UCSC Genome Browser(chr4:148,332,000-148,476,000) NCBI Gene(56273) IGTC(Pex14,2427) UNIGene(Mm.184172) |
MGI(1927868) KEGG GENES(mmu:56273) EST Profile(mm.184172) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W226 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB558984 | GSS Location | chr4:148,473,881-148,473,933 | Size | 53 |
| Sequence | AGTCAGGCCTGAGGAAGATGGCGTCGTCGGAGCAGGCAGAGCAGCCGAACCAG | ||||
| Links |
UCSC Browser(chr4:148,473,881-148,473,933) IGTC(Ayu21-W436) |
||||
Homology Search Results
| [AF097512] Mus musculus peroxisomal protein (Pex14) mRNA, complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Pex14) |
||||