ID 21-W272
Registered: 2009.08.29 Last update: 2018.09.05
| Gene Name | ELOVL family member 6, elongation of long chain fatty acids (yeast) | Gene Symbol | Elovl6 | |||
| Chromosome | 3 | Genomic Location | chr3:129,233,000-129,345,000 |  |
||
| Synonyms | Elo2, SUR4, Elo3-like, LCE, FEN1, FAE, C77826, MGC107467, EN1/Elo2, SUR4/Elo3-like, AE | |||||
| Links |
UCSC Genome Browser(chr3:129,233,000-129,345,000) NCBI Gene(170439) IGTC(Elovl6,3436) UNIGene(Mm.314113) |
MGI(2156528) KEGG GENES(mmu:170439) EST Profile(mm.314113) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W564, 21-W126, 21-W584 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB517698 | GSS Location | chr3:129,235,285-129,235,686 | Size | 250 |
| Sequence | GTAGACGAGTAAAAAGCGTGATGGACAAACGTGCGGGCACTAAGACCGCAAGGCATTCATTTCCT CCTACGGTGGATGCGGACGCTGGGAGGAGAGCCCCTGAGCTAGGAGCTGGGAGCAGAGGCGCAGA GAACACGTAGCGACTCCGAAGATCAGCCCCAATGAACATGTCAGTGTTGACTTTACAAGAATATG AATTCGAAAAGCAGTTCAACGAGAACGAAGCCATCCAATGGATGCAGGAAAACTG |
||||
| Links |
UCSC Browser(chr3:129,235,285-129,235,686) IGTC(Ayu21-W272) |
||||
Homology Search Results
| [BC100576] Mus musculus ELOVL family member 6, elongation of long chain fatty acids (yeast), mRNA (cDNA clone MGC:118673 IMAGE:30097278), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Elovl6) |
||||