Gene Name | ELOVL family member 6, elongation of long chain fatty acids (yeast) | Gene Symbol | Elovl6 | |||
Chromosome | 3 | Genomic Location | chr3:129,233,000-129,345,000 | |||
Synonyms | Elo2, SUR4, Elo3-like, LCE, FEN1, FAE, C77826, MGC107467 | |||||
Links |
UCSC Genome Browser(chr3:129,233,000-129,345,000) NCBI Gene(170439) IGTC(Elovl6,3436) UNIGene(Mm.314113) |
MGI(2156528) KEGG GENES(mmu:170439) EST Profile(mm.314113) |
Other Clone Trapped This Gene |
---|
21-W272, 21-W564, 21-W126 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB604778 | GSS Location | chr3:129,307,981-129,336,030 | Size | 315 |
Sequence | GCGCTGTACGCTGCCTTTATCTTTGGTGGTCGGCATCTGATGAACAAGCGAGCCAAGTTTGAACT TCGGAAGCCGCTCGTGCTCTGGTCGCTGACTCTTGCCGTCTTCAGTATATTCGGTGCTCTTCGAA CTGGTGCTTACATGCTGTACATTCTGATGACCAAAGGCCTGAAGCAGTCAGTTTGTGACCAGAGT TTTTACAATGGACCTGTCAGCAAATTCTGGGCTTATGCATTTGTGCTCAGCAAAGCACCCGAACT AGGTGACACGATATTCATCATTCTGAGGAAACAGAAACTGATCTTCCTGCACTGG |
||||
Links |
UCSC Browser(chr3:129,307,981-129,336,030) IGTC(Ayu21-W584) |
[BC100576] Mus musculus ELOVL family member 6, elongation of long chain fatty acids (yeast), mRNA (cDNA clone MGC:118673 IMAGE:30097278), complete cds. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Elovl6) |