Gene Name | tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 | Gene Symbol | Tanc1 | |||
Chromosome | 2 | Genomic Location | chr2:59,449,000-59,690,000 | ![]() |
||
Synonyms | Tanc, mKIAA1728, 1200003E16Rik | |||||
Links |
UCSC Genome Browser(chr2:59,449,000-59,690,000) NCBI Gene(66860) IGTC(Tanc1,2553) UNIGene(Mm.27917) |
MGI(1914110) KEGG GENES(mmu:66860) EST Profile(mm.27917) |
Other Clone Trapped This Gene |
---|
21-W44, 21-W579 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB514162 | GSS Location | chr2:59,450,099-59,450,253 | Size | 155 |
Sequence | GGGGACGGGCCGGAGCGCTGCCTCCGCGGTGGCAGCTGCGGGAGCCCGGCTCGGGAGCCGCAGGA GCCGCAGCCGCCAAGCGCCCAGCCCTCTGCGCCCTGAGGCTCGGCCCCCGGGGTGGGAACCGCGC CGAAAGCTGGAAACTTTCCTGGCAG |
||||
Links |
UCSC Browser(chr2:59,450,099-59,450,253) IGTC(Ayu21-W341) |
[NM_198294] Mus musculus tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 (Tanc1), mRNA. |
Card ID | 1685 | ||||
Strain Name | B6;CB-Tanc1Gt(pU-21W)341Card | ||||
Internal Code | Ayu21-W341 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Tanc1) |