ID 21-W341
Registered: 2009.08.08 Last update: 2010.11.26
| Gene Name | tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 | Gene Symbol | Tanc1 | |||
| Chromosome | 2 | Genomic Location | chr2:59,449,000-59,690,000 |  |
||
| Synonyms | Tanc, mKIAA1728, 1200003E16Rik | |||||
| Links |
UCSC Genome Browser(chr2:59,449,000-59,690,000) NCBI Gene(66860) IGTC(Tanc1,2553) UNIGene(Mm.27917) |
MGI(1914110) KEGG GENES(mmu:66860) EST Profile(mm.27917) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W44, 21-W579 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB514162 | GSS Location | chr2:59,450,099-59,450,253 | Size | 155 |
| Sequence | GGGGACGGGCCGGAGCGCTGCCTCCGCGGTGGCAGCTGCGGGAGCCCGGCTCGGGAGCCGCAGGA GCCGCAGCCGCCAAGCGCCCAGCCCTCTGCGCCCTGAGGCTCGGCCCCCGGGGTGGGAACCGCGC CGAAAGCTGGAAACTTTCCTGGCAG |
||||
| Links |
UCSC Browser(chr2:59,450,099-59,450,253) IGTC(Ayu21-W341) |
||||
Homology Search Results
| [NM_198294] Mus musculus tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 (Tanc1), mRNA. |
Mouse Information
| Card ID | 1685 | ||||
| Strain Name | B6;CB-Tanc1Gt(pU-21W)341Card | ||||
| Internal Code | Ayu21-W341 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Tanc1) |
||||