| Gene Name | tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 | Gene Symbol | Tanc1 | |||
| Chromosome | 2 | Genomic Location | chr2:59,449,000-59,690,000 | |||
| Synonyms | Tanc, mKIAA1728, 1200003E16Rik | |||||
| Links |
UCSC Genome Browser(chr2:59,449,000-59,690,000) NCBI Gene(66860) IGTC(Tanc1,2553) UNIGene(Mm.27917) |
MGI(1914110) KEGG GENES(mmu:66860) EST Profile(mm.27917) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W44, 21-W341 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB573691 | GSS Location | chr2:59,484,825-59,484,929 | Size | 105 |
| Sequence | GGAGCTGACTGTTGGGCACAGAGGAAGGACAGGAGAGAGAGCTGAGACATAAGGACCACTGTACC GCGTTTCTTCCTTCCATGAATGAGAAGATACCAGAGATAG |
||||
| Links |
UCSC Browser(chr2:59,484,825-59,484,929) IGTC(Ayu21-W579) |
||||
| [NM_198294] Mus musculus tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 (Tanc1), mRNA. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Tanc1) |
||||