Gene Name | tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 | Gene Symbol | Tanc1 | |||
Chromosome | 2 | Genomic Location | chr2:59,449,000-59,690,000 | ![]() |
||
Synonyms | Tanc, mKIAA1728, 1200003E16Rik | |||||
Links |
UCSC Genome Browser(chr2:59,449,000-59,690,000) NCBI Gene(66860) IGTC(Tanc1,2553) UNIGene(Mm.27917) |
MGI(1914110) KEGG GENES(mmu:66860) EST Profile(mm.27917) |
Other Clone Trapped This Gene |
---|
21-W44, 21-W341 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB573691 | GSS Location | chr2:59,484,825-59,484,929 | Size | 105 |
Sequence | GGAGCTGACTGTTGGGCACAGAGGAAGGACAGGAGAGAGAGCTGAGACATAAGGACCACTGTACC GCGTTTCTTCCTTCCATGAATGAGAAGATACCAGAGATAG |
||||
Links |
UCSC Browser(chr2:59,484,825-59,484,929) IGTC(Ayu21-W579) |
[NM_198294] Mus musculus tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 (Tanc1), mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Tanc1) |