Gene Name | nuclear receptor interacting protein 1 | Gene Symbol | Nrip1 | |||
Chromosome | 16 | Genomic Location | chr16:76,290,000-76,375,000 | ![]() |
||
Synonyms | RIP140, AA959574, AW456757, 9630050P12, 6030458L20Rik, 8430438I05Rik | |||||
Links |
UCSC Genome Browser(chr16:76,290,000-76,375,000) NCBI Gene(268903) IGTC(Nrip1,12962) UNIGene(Mm.455873) |
MGI(1315213) KEGG GENES(mmu:268903) EST Profile(mm.455873) |
Other Clone Trapped This Gene |
---|
21-W549 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB517953 | GSS Location | chr16:76,352,717-76,373,249 | Size | 211 |
Sequence | GGCGCAGGCGGAGGACGAGCCGGCCCCAGCCCGCCCGAGCGCAGCGCCCGTGGCCTCGCGCGGCC GCAGGGCACGGCTAACCTGGGAAGGAGGGAGCGACGCGGATCGGCGGCCCGGAGCCGCGGCGGCC TCGAAGGCGTGGACTGTGAGCGGTTGCAGAGCTGTTCTCAGGACATAATCCTTTAACATTCGGGA GGAACACATCCAGGAG |
||||
Links |
UCSC Browser(chr16:76,352,717-76,373,249) IGTC(Ayu21-W353) |
[NM_173440] Mus musculus nuclear receptor interacting protein 1 (Nrip1), mRNA. |
Card ID | 1626 | ||||
Strain Name | B6;CB-Nrip1Gt(pU-21W)353Card | ||||
Internal Code | Ayu21-W353 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Nrip1) |