ID 21-W549
Registered: 2010.11.23 Last update: 2010.11.23
| Gene Name | nuclear receptor interacting protein 1 | Gene Symbol | Nrip1 | |||
| Chromosome | 16 | Genomic Location | chr16:76,290,000-76,375,000 |  |
||
| Synonyms | RIP140, AA959574, AW456757, 9630050P12, 6030458L20Rik, 8430438I05Rik | |||||
| Links |
UCSC Genome Browser(chr16:76,290,000-76,375,000) NCBI Gene(268903) IGTC(Nrip1,12962) UNIGene(Mm.455873) |
MGI(1315213) KEGG GENES(mmu:268903) EST Profile(mm.455873) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W353 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB601836 | GSS Location | chr16:76,352,717-76,352,795 | Size | 80 |
| Sequence | CGAAGGCGTGGACTGTGAGCGGTTGCAGAGCTGTTCTCAGGACATAATCCTTTAACATTCGGGAG GAACACATCCAGGAG |
||||
| Links |
UCSC Browser(chr16:76,352,717-76,352,795) IGTC(Ayu21-W549) |
||||
Homology Search Results
| [NM_173440] Mus musculus nuclear receptor interacting protein 1 (Nrip1), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Nrip1) |
||||