Gene Name | bone morphogenetic protein receptor, type 1A | Gene Symbol | Bmpr1a | |||
Chromosome | 14 | Genomic Location | chr14:35,223,000-35,318,000 | ![]() |
||
Synonyms | Bmpr, ALK3, BMPR-IA, 1110037I22Rik, AU045487 | |||||
Links |
UCSC Genome Browser(chr14:35,223,000-35,318,000) NCBI Gene(12166) IGTC(Bmpr1a,2666) UNIGene(Mm.237825) |
MGI(1338938) KEGG GENES(mmu:12166) EST Profile(mm.237825) |
Other Clone Trapped This Gene |
---|
21-B126, 21-T177, 21-T344, 21-T437, 21-W506, 21-W275, 21-W493, 21-KBW225 |
Trap Vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
Accession | AB187234 | GSS Location | chr14:35,315,582-35,315,662 | Size | 81 |
Sequence | AGGCCGAGCCGGGCCCCGCCGCCCCGCGGCTGTCCGTGCCCGCCCGCGCCGAGCGCCGGAGGATG AGTTTCTCGGGATCCC |
||||
Links |
UCSC Browser(chr14:35,315,582-35,315,662) IGTC(Ayu21-17) |
[BC042611] Mus musculus bone morphogenetic protein receptor, type 1A, mRNA (cDNA clone MGC:36094 IMAGE:5364272), complete cds. |
Card ID | 459 | ||||
Strain Name | B6;CB-UnknownGt(Ayu21)17Imeg | ||||
Internal Code | Ayu21-17 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Bmpr1a) |