Gene Name | bone morphogenetic protein receptor, type 1A | Gene Symbol | Bmpr1a | |||
Chromosome | 14 | Genomic Location | chr14:35,223,000-35,318,000 | |||
Synonyms | 1110037I22Rik, ALK3, Bmpr, BMPR-IAALK3, SKR5; ALK-3, BMPR-1A, BMPR-IA, AU045487 | |||||
Links |
UCSC Genome Browser(chr14:35,223,000-35,318,000) NCBI Gene(12166) IGTC(Bmpr1a,2666) UNIGene(Mm.237825) |
MGI(1338938) KEGG GENES(mmu:12166) EST Profile(mm.237825) |
Other Clone Trapped This Gene |
---|
21-B126, 21-T344, 21-T437, 21-17, 21-W506, 21-W275, 21-W493, 21-KBW225 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB292613 | GSS Location | chr14:35,254,285-35,257,040 | Size | 139 |
Sequence | ACACTGCCCAGATGATGCTATTAATAACACATGCATAACTAATGGCCATTGCTTTGCCATTATAG AAGAAGATGATCAGGGAGAAACCACATTAACTTCTGGGTGTATGAAGTATGAAGGCTCTGATTTT CAATGCAAG |
||||
Links |
UCSC Browser(chr14:35,254,285-35,257,040) IGTC(Ayu21-T177) |
[BC042611] Mus musculus bone morphogenetic protein receptor, type 1A, mRNA (cDNA clone MGC:36094 IMAGE:5364272), complete cds. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Bmpr1a) |