ID 21-B126
Registered: 2007.02.01 Last update: 2018.04.05
| Gene Name | bone morphogenetic protein receptor, type 1A | Gene Symbol | Bmpr1a | |||
| Chromosome | 14 | Genomic Location | chr14:35,220,000-35,320,000 |  |
||
| Synonyms | Bmpr, ALK3, BMPR-IA, 1110037I22Rik, AU045487, SKR5, AU045487 | |||||
| Links |
UCSC Genome Browser(chr14:35,220,000-35,320,000) NCBI Gene(12166) IGTC(Bmpr1a,2666) UNIGene(Mm.237825) |
MGI(1338938) KEGG GENES(mmu:12166) EST Profile(mm.237825) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T177, 21-T344, 21-T437, 21-17, 21-W506, 21-W275, 21-W493, 21-KBW225 |
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB292674 | GSS Location | chr14:35,315,581-35,315,631 | Size | 51 |
| Sequence | GTCCGTGCCCGCCCGCGCCGAGCGCCGGAGGATGAGTTTCTCGGGATCCCG | ||||
| Links |
UCSC Browser(chr14:35,315,581-35,315,631) IGTC(Ayu21-B126) |
||||
Homology Search Results
| [AK132051] Mus musculus 12 days embryo head cDNA, RIKEN full-length enriched library, clone:3010002B09 product:bone morphogenetic protein receptor, type 1A, full insert sequence. |
Mouse Information
| Card ID | 794 | ||||
| Strain Name | B6;CB-Bmpr1aGt(pU-21B)126Imeg | ||||
| Internal Code | Ayu21-B126 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Bmpr1a) |
||||