Gene Name | bone morphogenetic protein receptor, type 1A | Gene Symbol | Bmpr1a | |||
Chromosome | 14 | Genomic Location | chr14:35,223,000-35,318,000 | |||
Synonyms | Bmpr, ALK3, BMPR-IA, AU045487, 1110037I22Rik | |||||
Links |
UCSC Genome Browser(chr14:35,223,000-35,318,000) NCBI Gene(12166) IGTC(Bmpr1a,2666) UNIGene(Mm.237825) |
MGI(1338938) KEGG GENES(mmu:12166) EST Profile(mm.237825) |
Other Clone Trapped This Gene |
---|
21-B126, 21-T177, 21-T344, 21-T437, 21-17, 21-W506, 21-W275, 21-W493 |
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB626083 | GSS Location | chr14:35,315,581-35,315,740 | Size | 160 |
Sequence | CGTCGGCCCCGCGCGAGACGACGACTGTACGGCCGCGCGAGGGGCGACCGGGCCCGGGCCGCTGC ACGCCGAGGGCGGAGGCCGAGCCGGGCCCCGCCGCCCCGCGGCTGTCCGTGCCCGCCCGCGCCGA GCGCCGGAGGATGAGTTTCTCGGGATCCCG |
||||
Links |
UCSC Browser(chr14:35,315,581-35,315,740) IGTC(Ayu21-KBW225) |
[AK132051] Mus musculus 12 days embryo head cDNA, RIKEN full-length enriched library, clone:3010002B09 product:bone morphogenetic protein receptor, type 1A, full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Bmpr1a) |