ID 21-KBT47
Registered: 2015.06.03 Last update: 2015.06.04
| Gene Name | erythroid differentiation regulator 1 | Gene Symbol | Erdr1 | |||
| Chromosome | Y | Genomic Location | Unlocalized |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(Unlocalized) NCBI Gene() IGTC(Erdr1,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW113, 21-KBW106, 21-KBW112, 21-T47, 21-KBW221, 21-KBW177, 21-W14, 21-KBW116, 21-KBW178, 21-KBW183, 21-W347, 21-KBW154, 21-W442, 21-KBW209, 21-W521, 21-KBW241, 21-KBW252, 21-B173, 21-7, 21-62 |
| Trap Vector | pU-21T | Cell Line | KAB6 (Albino B6) | Method | 5'-Inverse PCR |
| Accession | DE999383 | GSS Location | Unlocalized | Size | 218 |
| Sequence | GCCGCCTTCCCGCCACTCACTCTGAAAGCCCATAGAGAACCATTGACTACGGCAGGACTACAACT CCCAGCATGCCTCGGGGCCGCCTTCCCGCCACTCACTCTGAAAGCCCATAGAGAACCATTGACGA CGGCAGGACTACAACTCCCAGCATGCCTCGGGGCCGCCTTCCCGCCACTCACTCTGAAAGCCCAT AGAGAACCATTGACTACAATGTT |
||||
| Links |
UCSC Browser(Unlocalized) IGTC(Ayu21-KBT47) |
||||
Homology Search Results
| [AJ539223] Mus musculus mRNA for erythroid differentiation regulator (edr gene). |
Mouse Information
| Card ID | 1237 | ||||
| Strain Name | B6-Erdr1Gt(pU-21KBT)47Card | ||||
| Internal Code | Ayu21-KBT47 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. This sequence-tag is genomic sequence of 5'-flanking region obtained by inverse PCR. | ||||
| Links |
IMSR (for Erdr1) |
||||