ID 21-T47

Registered: 2006.07.02   Last update: 2019.04.16
Gene Name erythroid differentiation regulator 1 Gene Symbol Erdr1
Chromosome Y Genomic Location
Synonyms edr, MGC5764
Links UCSC Genome Browser()
NCBI Gene(170942)
IGTC(Erdr1,)
UNIGene(Mm.391385)
MGI(2384747)
KEGG GENES(mmu:170942)
EST Profile(mm.391385)
Other Clone Trapped This Gene
21-KBW113, 21-KBT47, 21-KBW106, 21-KBW112, 21-KBW221, 21-KBW177, 21-W14, 21-KBW116, 21-KBW178, 21-KBW183, 21-W347, 21-KBW154, 21-W442, 21-KBW209, 21-W521, 21-KBW241, 21-KBW252, 21-B173, 21-7, 21-62
Trap Vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB264307 GSS Location Unlocalized Size 125
Sequence CAGCGTCCACCGGGCACTGCCGCCGCCCACAGTNACGTCACCCACGCAAGCACACACGTAGTTGC
GGACGCCGTGGTCAAGATGTCTCTGCCATCCCCACGGGACGGACGGACGGACTCCACAAG
Links UCSC Browser(Unlocalized)
IGTC(Ayu21-T47)

Homology Search Results

[AJ539223] Mus musculus mRNA for erythroid differentiation regulator (edr gene).

Mouse Information

Card ID 2824
Strain Name B6;CB-Erdr1Gt(pU-21T)47Card
Internal Code Ayu21-T47
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Erdr1)