Gene Name | erythroid differentiation regulator 1 | Gene Symbol | Erdr1 | |||
Chromosome | Y | Genomic Location | Unlocalized | ![]() |
||
Synonyms | edr, MGC5764 | |||||
Links |
UCSC Genome Browser(Unlocalized) NCBI Gene(170942) IGTC(Erdr1,) UNIGene(Mm.391385) |
MGI(2384747) KEGG GENES(mmu:170942) EST Profile(mm.391385) |
Other Clone Trapped This Gene |
---|
21-KBW113, 21-KBT47, 21-KBW106, 21-KBW112, 21-T47, 21-KBW221, 21-KBW177, 21-W14, 21-KBW116, 21-KBW178, 21-KBW183, 21-W347, 21-KBW154, 21-W442, 21-KBW209, 21-W521, 21-KBW241, 21-KBW252, 21-7, 21-62 |
Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB252561 | GSS Location | Unlocalized | Size | 161 |
Sequence | CACGTGTTTCTCTGTTTATGGACCTGGATCCCACGCCAGCGTCCACCGGTCACTGCCGCCGCCCA CAGTGATGTCACCCACGAAAGCACACACGTAGAAGCGGACGCCGTGGTCAAGATGTCTCTGCCAT CCCCACAGGACGGACGGACGGACTCCACAAG |
||||
Links |
UCSC Browser(Unlocalized) IGTC(Ayu21-B173) |
[BC086616] Mus musculus cDNA clone IMAGE:5719021. |
Card ID | 707 | ||||
Strain Name | B6;CB-<i>Erdr1<sup>Gt(pU-21B)173Imeg</sup></i> | ||||
Internal Code | Ayu21-B173 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Erdr1) |