Gene Name | erythroid differentiation regulator 1 | Gene Symbol | Erdr1 | |||
Chromosome | Y | Genomic Location | ||||
Synonyms | edr, MGC:5764 | |||||
Links |
UCSC Genome Browser() NCBI Gene(170942) IGTC(Erdr1,) UNIGene(Mm.391385) |
MGI(2384747) KEGG GENES(mmu:170942) EST Profile(mm.391385) |
Other Clone Trapped This Gene |
---|
21-KBW113, 21-KBT47, 21-KBW106, 21-KBW112, 21-T47, 21-KBW177, 21-W14, 21-KBW116, 21-KBW178, 21-KBW183, 21-W347, 21-KBW154, 21-W442, 21-KBW209, 21-W521, 21-KBW241, 21-KBW252, 21-B173, 21-7, 21-62 |
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB624520 | GSS Location | Size | 162 | |
Sequence | CACTCGCTCCTGGGATCGCCATGTGCTCGCAGCTCCGCGGACGTCCCCGGCTCCCCGCCGTCTCC CCGCGATCGGACTCGGCCTCCGCCGCCCGCGCACGGCCCCGCCGGCTCCCCTCCGCCTCCCCGGG CCTCCTGAGTTCACTTTAAATTCACAGCTGAG |
||||
Links |
UCSC Browser() IGTC() |
[CR536618] Mouse DNA sequence from clone RP24-143B12 on chromosome X, complete sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Erdr1) |