ID 21-T155
Registered: 2007.01.18 Last update: 2018.06.01
| Gene Name | transcriptional regulating factor 1 | Gene Symbol | Trerf1 | |||
| Chromosome | 17 | Genomic Location | chr17:47,270,000-47,500,000 |  |
||
| Synonyms | 9430096I18Rik, Trep132, Trep-132, RAPA, AI429294, B830015H24 | |||||
| Links |
UCSC Genome Browser(chr17:47,270,000-47,500,000) NCBI Gene(224829) IGTC(Trerf1,14289) UNIGene(Mm.260989) |
MGI(2442086) KEGG GENES(mmu:224829) EST Profile(mm.260989) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W393, 21-W479, 21-KBW258, K14A05 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB290809 | GSS Location | chr17:47,278,773-47,278,858 | Size | 87 |
| Sequence | ACTCGGCTCGCCCCCCATCTCACCCCCCCAAGTGGAGATTGGTCGTCTTGTCGGATTGCCCAGGC ACTTGTTGCCGAAACAGCCAAG |
||||
| Links |
UCSC Browser(chr17:47,278,773-47,278,858) IGTC(Ayu21-T155) |
||||
Homology Search Results
| [BC059215] Mus musculus transcriptional regulating factor 1, mRNA (cDNA clone MGC:66566 IMAGE:6412734), complete cds. |
Mouse Information
| Card ID | 1099 | ||||
| Strain Name | B6;CB-Tref1Gt(pU-21T)155Imeg | ||||
| Internal Code | Ayu21-T155 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Trerf1) |
||||